View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1281_high_51 (Length: 212)

Name: NF1281_high_51
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1281_high_51
NF1281_high_51
[»] chr3 (2 HSPs)
chr3 (36-161)||(27687365-27687490)
chr3 (37-155)||(27687248-27687366)


Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 36 - 161
Target Start/End: Original strand, 27687365 - 27687490
Alignment:
Q  36 atgaacaaacctagatctaaaaggacagaactgatatcattaatcaagtgaaacagagaggagtaaacgaaaacacgttttgaattaggtgcagtgcaca 135  Q
    ||||||||||||| |||| ||||||||||| ||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||     
T  27687365 atgaacaaacctacatctgaaaggacagaattgatatcgttaatcaagtgaaacagagaggagcaaacgaaaacacgttttgaattaggtgcagtgcacg 27687464  T
Q  136 acgtacttgccgggagcaatcaaacc 161  Q
    ||||| ||||||||||||||||||||    
T  27687465 acgtagttgccgggagcaatcaaacc 27687490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 37 - 155
Target Start/End: Original strand, 27687248 - 27687366
Alignment:
Q  37 tgaacaaacctagatctaaaaggacagaactgatatcattaatcaagtgaaacagagaggagtaaacgaaaacacgttttgaattaggtgcagtgcacaa 136  Q
    ||||||||||||| | | |||||||||||| |||||| | ||||||| |||||||||||||| |||| |||||||||||||||||||||||||||||| |    
T  27687248 tgaacaaacctagttttgaaaggacagaaccgatatcgtcaatcaagagaaacagagaggagcaaacaaaaacacgttttgaattaggtgcagtgcacga 27687347  T
Q  137 cgtacttgccgggagcaat 155  Q
     ||| ||||||||||||||    
T  27687348 tgtagttgccgggagcaat 27687366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University