View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12816_low_18 (Length: 201)

Name: NF12816_low_18
Description: NF12816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12816_low_18
NF12816_low_18
[»] chr5 (1 HSPs)
chr5 (111-185)||(229851-229925)


Alignment Details
Target: chr5 (Bit Score: 75; Significance: 9e-35; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 75; E-Value: 9e-35
Query Start/End: Original strand, 111 - 185
Target Start/End: Complemental strand, 229925 - 229851
Alignment:
Q  111 gccaagcttaagagtaaagcccctgcattggcacctgtgctctcgccatcagatgctcccgctcccggactctct 185  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  229925 gccaagcttaagagtaaagcccctgcattggcacctgtgctctcgccatcagatgctcccgctcccggactctct 229851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University