View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1280_low_18 (Length: 330)

Name: NF1280_low_18
Description: NF1280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1280_low_18
NF1280_low_18
[»] chr7 (1 HSPs)
chr7 (135-245)||(41130828-41130938)


Alignment Details
Target: chr7 (Bit Score: 99; Significance: 8e-49; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 135 - 245
Target Start/End: Complemental strand, 41130938 - 41130828
Alignment:
Q  135 aacctagtttacctcctctttgatatcgtctccaaatcataattactattatagtctcttccttcaaaacggtacgttccatctttcttatttggtttta 234  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||     
T  41130938 aacctagtttacctcctctttgatatcgtctccaaatcataattactattatagtctcttccttcaaaacggtacgttccatctttcttatttaattttt 41130839  T
Q  235 ataattatatt 245  Q
    |||||||||||    
T  41130838 ataattatatt 41130828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University