View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1280_high_25 (Length: 273)

Name: NF1280_high_25
Description: NF1280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1280_high_25
NF1280_high_25
[»] chr3 (1 HSPs)
chr3 (147-234)||(38090506-38090593)
[»] chr4 (1 HSPs)
chr4 (147-179)||(32730697-32730729)


Alignment Details
Target: chr3 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 147 - 234
Target Start/End: Complemental strand, 38090593 - 38090506
Alignment:
Q  147 cataccgtccatgtcttgattctagctccattttccgttccagtgaagatgctgtgtgacacatgcacctcttctacagtagcatatt 234  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38090593 cataccgtccatgtcttgattctagctccattttccgttccagtgaagatgctgtgtgacacatgcacctcttctacagtagcatatt 38090506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 147 - 179
Target Start/End: Complemental strand, 32730729 - 32730697
Alignment:
Q  147 cataccgtccatgtcttgattctagctccattt 179  Q
    |||||||||||||||||||||||||| ||||||    
T  32730729 cataccgtccatgtcttgattctagcaccattt 32730697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University