View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12809_low_5 (Length: 205)

Name: NF12809_low_5
Description: NF12809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12809_low_5
NF12809_low_5
[»] chr8 (2 HSPs)
chr8 (13-187)||(40805434-40805609)
chr8 (151-187)||(40825978-40826014)


Alignment Details
Target: chr8 (Bit Score: 132; Significance: 9e-69; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 13 - 187
Target Start/End: Complemental strand, 40805609 - 40805434
Alignment:
Q  13 cgttcactgcaccatcaaaaaggtatctacaccatat-atgcatgccacactactagttaagcaataatatctctcaccaagacatctactaataattta 111  Q
    ||||| |||||||||||||||||||||||||  | |  ||  ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40805609 cgttctctgcaccatcaaaaaggtatctacagtacaccatatatgccactctactagttaagcaataatatctctcaccaagacatctactaataattta 40805510  T
Q  112 atgttgaatttaacttatttataattaatttttatctgtattttgcagagattattagcttttggatgttgggaag 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  40805509 atgttgaatttaacttatttataattaatttttatctgtattttgcagagattactagcttttggatgttgggaag 40805434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 187
Target Start/End: Complemental strand, 40826014 - 40825978
Alignment:
Q  151 attttgcagagattattagcttttggatgttgggaag 187  Q
    ||||||||||||||| ||||||||||||| |||||||    
T  40826014 attttgcagagattactagcttttggatgctgggaag 40825978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University