View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12787_low_30 (Length: 245)

Name: NF12787_low_30
Description: NF12787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12787_low_30
NF12787_low_30
[»] chr3 (1 HSPs)
chr3 (9-245)||(45201234-45201472)


Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 9 - 245
Target Start/End: Original strand, 45201234 - 45201472
Alignment:
Q  9 tcgttcactgtcttcactctctat--ctactcttcttaacaacccaatctacttcaaattaacacagcaaccaccacatatctcaccggagacggacgaa 106  Q
    ||||||||||||||| ||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45201234 tcgttcactgtcttccctctctatatctactcttcttaacaacccaatctacttcaaattaacacagcaaccaccacatatctcaccggagacggacgaa 45201333  T
Q  107 aatggaagaggttccgccaccggaggtccagataaacggcggagcaacaactgcagtaacactacccccttccgaacctcatggatcgaagcggcaacgc 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45201334 aatggaagaggttccgccaccggaggtccagataaacggcggagcaacaactgcagtaacactacccccttccgaacctcatggatcgaagcggcaacgc 45201433  T
Q  207 cgacccagcgtccgattaggcgatatcggagaccaaccc 245  Q
    |||||||||||||||||||||||||||||||||||||||    
T  45201434 cgacccagcgtccgattaggcgatatcggagaccaaccc 45201472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University