View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12786_low_8 (Length: 237)

Name: NF12786_low_8
Description: NF12786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12786_low_8
NF12786_low_8
[»] chr2 (1 HSPs)
chr2 (1-232)||(16487767-16487998)


Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 16487998 - 16487767
Alignment:
Q  1 ttgaatgaaagcatcggtttcacgtgttcggggagttcggtaactttcttccccttgatctcgctgtagaatctcctcatcgccattgctgaattgctcg 100  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16487998 ttgaatgaaagcattggtttcacgtgttcggggagttcggtaactttcttccccttgatctcgctgtagaatctcctcatcgccattgctgaattgctcg 16487899  T
Q  101 attgattccgcaaaccctagaaatttagattcagaacgctgtttctctgaatacggaaatgaacgctgtttcacttgtggttgaaaatgaaattgggtga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16487898 attgattccgcaaaccctagaaatttagattcagaacgctgtttctctgaatacggaaatgaacgctgtttcacttgtggttgaaaatgaaattgggtga 16487799  T
Q  201 attggtgtattgccccattcatctcactcgac 232  Q
    |||||||||||||||||||||| |||| ||||    
T  16487798 attggtgtattgccccattcatgtcacccgac 16487767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University