View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12779_low_50 (Length: 231)

Name: NF12779_low_50
Description: NF12779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12779_low_50
NF12779_low_50
[»] chr2 (1 HSPs)
chr2 (72-221)||(17113020-17113164)


Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 72 - 221
Target Start/End: Complemental strand, 17113164 - 17113020
Alignment:
Q  72 ttggaggcattgttgcgtaaggaactcaactcagtcttgttgggaatagtggctaaagaattgaatccaagtgatgatatgatgtctataacaaccatac 171  Q
    |||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||     || ||||||||||||||    
T  17113164 ttggaggcgttgttgcgtaaggaactcaactcagtcttgttggcaatagtggctaaagaattgaatccaagtgatgat-----gtttataacaaccatac 17113070  T
Q  172 atgagaaaggtgctgcttttaacaattatttttggataatgtttgccttt 221  Q
    ||||||||| ||||||||||||| ||||||||||||||||||||||||||    
T  17113069 atgagaaagttgctgcttttaaccattatttttggataatgtttgccttt 17113020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University