View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12779_low_36 (Length: 249)

Name: NF12779_low_36
Description: NF12779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12779_low_36
NF12779_low_36
[»] chr7 (1 HSPs)
chr7 (6-233)||(41847406-41847633)
[»] chr1 (2 HSPs)
chr1 (72-233)||(26889516-26889677)
chr1 (105-206)||(49732861-49732962)
[»] chr5 (1 HSPs)
chr5 (95-185)||(22837638-22837728)


Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 6 - 233
Target Start/End: Complemental strand, 41847633 - 41847406
Alignment:
Q  6 agtagcaaagggggtgtggatagagatagtgatggaacaacaactgaaacagatagaagcaaattagtgttttttgatagaaggaatgagtttgagttag 105  Q
    |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41847633 agtaacaatgggggtgtggatagagatagtgatggaacaacaactgaaacagatagaagcaaattagtgttttttgatagaaggaatgagtttgagttag 41847534  T
Q  106 aggatttgctacgagcttctgcagagatgcttgggaagggtagtttgggaactgtttatagagctgttcttgatgatggatgtactgttgctgttaagag 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41847533 aggatttgctacgagcttctgcagagatgcttgggaagggtagtttgggaactgtttatagagctgttcttgatgatggatgtactgttgctgttaagag 41847434  T
Q  206 acttaaggatgctaatccttgtgatagg 233  Q
    ||||||||||||||||||||||||||||    
T  41847433 acttaaggatgctaatccttgtgatagg 41847406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 72 - 233
Target Start/End: Original strand, 26889516 - 26889677
Alignment:
Q  72 gtgttttttgatagaaggaatgagtttgagttagaggatttgctacgagcttctgcagagatgcttgggaagggtagtttgggaactgtttatagagctg 171  Q
    |||||||||||||| |||||||  |||||||| || |||||| | || || ||||| |||||||||||||||||||||||||||||||||||||| || |    
T  26889516 gtgttttttgataggaggaatggatttgagttggaagatttgttgcgtgcatctgctgagatgcttgggaagggtagtttgggaactgtttatagggcag 26889615  T
Q  172 ttcttgatgatggatgtactgttgctgttaagagacttaaggatgctaatccttgtgatagg 233  Q
    | |||||||||||  |||| |||||||| ||||| ||||| ||||| |||||||||| ||||    
T  26889616 tgcttgatgatggtagtacggttgctgtcaagaggcttaaagatgcaaatccttgtgctagg 26889677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 105 - 206
Target Start/End: Original strand, 49732861 - 49732962
Alignment:
Q  105 gaggatttgctacgagcttctgcagagatgcttgggaagggtagtttgggaactgtttatagagctgttcttgatgatggatgtactgttgctgttaaga 204  Q
    ||||||||| |||| ||||| || || ||| | ||||| ||| | || ||||||| ||||| |||||||||||||||||||  |  ||||||||| ||||    
T  49732861 gaggatttgttacgtgcttcagctgaaatgttagggaaaggtggatttggaactgcttataaagctgttcttgatgatggaaatgttgttgctgtgaaga 49732960  T
Q  205 ga 206  Q
    ||    
T  49732961 ga 49732962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 95 - 185
Target Start/End: Original strand, 22837638 - 22837728
Alignment:
Q  95 gtttgagttagaggatttgctacgagcttctgcagagatgcttgggaagggtagtttgggaactgtttatagagctgttcttgatgatgga 185  Q
    ||||||| ||||||||||||| || ||||| || || ||| | ||||||||||  || |||||||| |||| |||||||||||||||||||    
T  22837638 gtttgagctagaggatttgcttcgtgcttcggcggaaatgttggggaagggtaccttaggaactgtctataaagctgttcttgatgatgga 22837728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University