View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12779_high_40 (Length: 243)

Name: NF12779_high_40
Description: NF12779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12779_high_40
NF12779_high_40
[»] chr8 (1 HSPs)
chr8 (1-193)||(38933027-38933208)


Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 38933208 - 38933027
Alignment:
Q  1 agcagagaaagtgctagaaatcagaccctacaaaaagttatacggcaaatggacaatttttccagtaatggatgtatagatattagatagaggggtctaa 100  Q
    ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||           ||||||||||||||||    
T  38933208 agcagagaaagtgttagaaatcagaccctacaaaaagttctacggcaaatggacaatttttccagtaatggat-----------agatagaggggtctaa 38933120  T
Q  101 aactacagttccttctttcttagtcggccattcataaatactaggtgggtccaaaccataacaaaacaaaatatatgacataacacaaacaca 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38933119 aactacagttccttctttcttagtcggccattcataaatactaggtgggtccaaaccataacaaaacaaaatatatgacataacacaaacaca 38933027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University