View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12772_low_22 (Length: 241)

Name: NF12772_low_22
Description: NF12772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12772_low_22
NF12772_low_22
[»] chr1 (1 HSPs)
chr1 (18-68)||(35354484-35354534)


Alignment Details
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 35354484 - 35354534
Alignment:
Q  18 atatagtctctggaaatcacatttcaaactaattactcaatgtaaaccatt 68  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35354484 atatagtctctggaaatcacatttcaaactaattactcaatgtaaaccatt 35354534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University