View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12767_high_39 (Length: 213)

Name: NF12767_high_39
Description: NF12767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12767_high_39
NF12767_high_39
[»] chr1 (1 HSPs)
chr1 (21-200)||(35338174-35338353)


Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 21 - 200
Target Start/End: Complemental strand, 35338353 - 35338174
Alignment:
Q  21 tacattgcccctggtgagaattcattcaaatacattctattttctttttcctcttcaatcattgttgcattttatacaaggttttatgccgatgttattt 120  Q
    ||||||||||||||||||||||||| |||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| ||||||||||    
T  35338353 tacattgcccctggtgagaattcatccaaacacattctattttatttttcatcttcaatcattgttgcattttatacaaggttttatgctgatgttattt 35338254  T
Q  121 tttatttattggtcatgtttagccatagttggacagattgaaccatgacttagagatctcattggctagttcaatctctg 200  Q
    |||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||    
T  35338253 tttatttatttgtcatgtttagccatagttggaccgattgaaccatgacttagagatctcattagctagttcaatctctg 35338174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University