View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1275_low_52 (Length: 207)

Name: NF1275_low_52
Description: NF1275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1275_low_52
NF1275_low_52
[»] chr8 (1 HSPs)
chr8 (53-91)||(3666100-3666138)


Alignment Details
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 53 - 91
Target Start/End: Complemental strand, 3666138 - 3666100
Alignment:
Q  53 tatgggtattattttctgaaacagaaatgaaataatatt 91  Q
    |||||||||||||||||||||||||||||||||||||||    
T  3666138 tatgggtattattttctgaaacagaaatgaaataatatt 3666100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University