View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1275R-Insertion-4 (Length: 224)

Name: NF1275R-Insertion-4
Description: NF1275R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1275R-Insertion-4
NF1275R-Insertion-4
[»] chr7 (2 HSPs)
chr7 (9-124)||(39322331-39322446)
chr7 (147-195)||(39322444-39322492)


Alignment Details
Target: chr7 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 9 - 124
Target Start/End: Original strand, 39322331 - 39322446
Alignment:
Q  9 aataatagttgataaacaatttccccttcaagaatttcaaagtagcgtattatattaatatgcaaattcctgttcgaaaaaataaaatcagtcacatatt 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  39322331 aataatagttgataaacaatttccccttcaagaatttcaaagtagcgtattatattaatatgcaaattcctgttcgaaaaaataaaatcattcacatatt 39322430  T
Q  109 atggtcagtgtacaaa 124  Q
    ||||||||||||||||    
T  39322431 atggtcagtgtacaaa 39322446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 147 - 195
Target Start/End: Original strand, 39322444 - 39322492
Alignment:
Q  147 aaataatttacaaatatgcaaaagtaaagttccaggatggcacacaggt 195  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||    
T  39322444 aaataatttacaaataagcaaaagtaaagttccaggatggcacacaggt 39322492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University