View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1274_low_46 (Length: 353)

Name: NF1274_low_46
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1274_low_46
NF1274_low_46
[»] chr4 (1 HSPs)
chr4 (31-344)||(44704271-44704584)


Alignment Details
Target: chr4 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 31 - 344
Target Start/End: Complemental strand, 44704584 - 44704271
Alignment:
Q  31 tatttacaaggattttttgtacaattatcagtcaagattgatgctatgaaaacgagaataacttgtgaatatttttgtcttctctttcaaattgtttctg 130  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44704584 tatttacaaggattttttgtacaattatcagtcaagattgatgccatgaaaacgagaataacttgtgaatatttttgtcttctctttcaaattgtttctg 44704485  T
Q  131 tacagaatttgtgaaggaagatgtgaagcttcaggttgatagcagtggccgtattgttgtcaagggagaaaggcaagcaagtgagcagaaacgtgttcgt 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44704484 tacagaatttgtgaaggaagatgtgaagcttcaggttgatagcagtggccgtattgttgtcaagggagaaaggcaagcaagtgagcagaaacgtgttcgt 44704385  T
Q  231 tttcacctgagttttccagaaccaaatgattctgagattgataacatagccggaaaattcgatgggggaatcctttacgtgactctccccaagcgaattg 330  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44704384 tttcacctgagttttccagaaccaaatgattctgagattgataacatagccggaaaattcgatgggggaatcctttacgtgactctccccaagcgaattg 44704285  T
Q  331 tacaagagaataat 344  Q
    ||||||||||||||    
T  44704284 tacaagagaataat 44704271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University