View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1274_low_119 (Length: 205)

Name: NF1274_low_119
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1274_low_119
NF1274_low_119
[»] chr8 (1 HSPs)
chr8 (1-118)||(3683913-3684031)


Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 3683913 - 3684031
Alignment:
Q  1 tgttgatcctcattgctcagatactatgtgcttgtcaatcaaacaagatgttttcccattttcaca-ttttttgtttagcaaatatttatggtcgaaata 99  Q
    ||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||    
T  3683913 tgttgatcctcattgctcagatactctgtgcttgtcaatcaaataagatgttttccctttttcacatttttttgtttagcaaatatttatggtcgaaata 3684012  T
Q  100 ttgaatcaagtaatttttt 118  Q
    |||||||| ||||||||||    
T  3684013 ttgaatcaggtaatttttt 3684031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University