View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1274_low_117 (Length: 206)

Name: NF1274_low_117
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1274_low_117
NF1274_low_117
[»] chr3 (3 HSPs)
chr3 (2-126)||(42378327-42378451)
chr3 (2-126)||(42407041-42407165)
chr3 (31-61)||(50057088-50057118)


Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 2 - 126
Target Start/End: Original strand, 42378327 - 42378451
Alignment:
Q  2 ctatcctagatcattagtttatagagtaacacccctcaccttacaagccagttttgtaagctctgcccaaattctaacatgaaatcacattcaaagattt 101  Q
    |||||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42378327 ctatcctagatcattagtatatagactgacacccctcaccttacaagccagttttgtaagctctgcccaaattctaacatgaaatcacattcaaagattt 42378426  T
Q  102 tgccaataatgtctaataaggaagg 126  Q
    |||||||||||||||||||||||||    
T  42378427 tgccaataatgtctaataaggaagg 42378451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 2 - 126
Target Start/End: Original strand, 42407041 - 42407165
Alignment:
Q  2 ctatcctagatcattagtttatagagtaacacccctcaccttacaagccagttttgtaagctctgcccaaattctaacatgaaatcacattcaaagattt 101  Q
    |||||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42407041 ctatcctagatcattagtatatagactgacacccctcaccttacaagccagttttgtaagctctgcccaaattctaacatgaaatcacattcaaagattt 42407140  T
Q  102 tgccaataatgtctaataaggaagg 126  Q
    |||||||||||||||||||||||||    
T  42407141 tgccaataatgtctaataaggaagg 42407165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 61
Target Start/End: Original strand, 50057088 - 50057118
Alignment:
Q  31 cacccctcaccttacaagccagttttgtaag 61  Q
    |||||||||||||||||||||||||||||||    
T  50057088 cacccctcaccttacaagccagttttgtaag 50057118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University