View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12742_high_29 (Length: 201)

Name: NF12742_high_29
Description: NF12742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12742_high_29
NF12742_high_29
[»] scaffold0339 (2 HSPs)
scaffold0339 (23-186)||(16077-16240)
scaffold0339 (127-186)||(2866-2925)
[»] chr4 (2 HSPs)
chr4 (127-186)||(47273641-47273700)
chr4 (68-105)||(47296385-47296422)


Alignment Details
Target: scaffold0339 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: scaffold0339
Description:

Target: scaffold0339; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 23 - 186
Target Start/End: Original strand, 16077 - 16240
Alignment:
Q  23 agggaaaggcaaggatgctgattgggtgcaaaaagctaatatagctttgaataaggtatatctcgtttcattgtgtatgtttggaatcacagtgacaccg 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  16077 agggaaaggcaaggatgctgattgggtgcaaaaagctaatatagctttgaataaggtatatctcgtttcattgtgtatgtttggaatcacagtgacacca 16176  T
Q  123 cggttctatgaaactcgtgtcaattcaaacatgcacttaaatgcattcactgtgaacccctttg 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16177 cggttctatgaaactcgtgtcaattcaaacatgcacttaaatgcattcactgtgaacccctttg 16240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0339; HSP #2
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 127 - 186
Target Start/End: Complemental strand, 2925 - 2866
Alignment:
Q  127 tctatgaaactcgtgtcaattcaaacatgcacttaaatgcattcactgtgaacccctttg 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2925 tctatgaaactcgtgtcaattcaaacatgcacttaaatgcattcactgtgaacccctttg 2866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 60; Significance: 8e-26; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 127 - 186
Target Start/End: Complemental strand, 47273700 - 47273641
Alignment:
Q  127 tctatgaaactcgtgtcaattcaaacatgcacttaaatgcattcactgtgaacccctttg 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47273700 tctatgaaactcgtgtcaattcaaacatgcacttaaatgcattcactgtgaacccctttg 47273641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 68 - 105
Target Start/End: Complemental strand, 47296422 - 47296385
Alignment:
Q  68 tttgaataaggtatatctcgtttcattgtgtatgtttg 105  Q
    |||||||||||||||||| |||||||||||||||||||    
T  47296422 tttgaataaggtatatcttgtttcattgtgtatgtttg 47296385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University