View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1273_low_35 (Length: 316)

Name: NF1273_low_35
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1273_low_35
NF1273_low_35
[»] chr4 (1 HSPs)
chr4 (102-241)||(1602372-1602511)


Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 102 - 241
Target Start/End: Complemental strand, 1602511 - 1602372
Alignment:
Q  102 cagcaggttgggaacagtaatagtctagatctaatgatcgttgaaggatgttaattactagatgttggaccattacaacttacgagttggatatgattca 201  Q
    ||||||||||| || ||||||| |||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||||||||||    
T  1602511 cagcaggttggaaaaagtaataatctagatctaatgatcgttgaaggatgttagttactagatgttgggccgttacaacttacgagttggatatgattca 1602412  T
Q  202 atgatgatgatgatgagtcatggtggattgacctttgctt 241  Q
    |||||||||||||||||| |||||||||||||||||||||    
T  1602411 atgatgatgatgatgagttatggtggattgacctttgctt 1602372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University