View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1273_high_21 (Length: 256)

Name: NF1273_high_21
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1273_high_21
NF1273_high_21
[»] chr3 (1 HSPs)
chr3 (44-256)||(39762990-39763202)
[»] chr8 (1 HSPs)
chr8 (139-245)||(38127516-38127622)
[»] chr1 (1 HSPs)
chr1 (52-101)||(10652987-10653036)


Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 44 - 256
Target Start/End: Original strand, 39762990 - 39763202
Alignment:
Q  44 ttatcatctacataatggagcaggcatttgggttttcatcactaaacatggtggtgaggtgtggctcttcatatgctctaacagttccagtggtttccaa 143  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39762990 ttatcatctacataatggagcaggcatttgggttttcatcactaaacatggtggtgaggtgtggctcttcatatgctctaacagttccagtggtttccaa 39763089  T
Q  144 tctccttacatatccaggaggagccttcttgtcataagaaggagcagtgtatggatgaaccaccatgttgtatggcacataaggccatatctctgccttc 243  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39763090 tctccttacatatccaggaggagccttcttgtcataagaaggagcagcgtatggatgaaccaccatgttgtatggcacataaggccatatctctgccttc 39763189  T
Q  244 ttttctgtcgact 256  Q
    ||| |||| ||||    
T  39763190 tttcctgttgact 39763202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 139 - 245
Target Start/End: Original strand, 38127516 - 38127622
Alignment:
Q  139 tccaatctccttacatatccaggaggagccttcttgtcataagaaggagcagtgtatggatgaaccaccatgttgtatggcacataaggccatatctctg 238  Q
    |||| |||||| ||||| |||||||||||||||||||||||||||| | |||  ||||| ||| |||||| ||||||||||||||||||||| || || |    
T  38127516 tccactctcctcacataaccaggaggagccttcttgtcataagaagaaacagcatatggttgagccaccaagttgtatggcacataaggccaaatttcag 38127615  T
Q  239 ccttctt 245  Q
    |||||||    
T  38127616 ccttctt 38127622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 52 - 101
Target Start/End: Complemental strand, 10653036 - 10652987
Alignment:
Q  52 tacataatggagcaggcatttgggttttcatcactaaacatggtggtgag 101  Q
    ||||| ||||| || ||||| ||||||||||||||||||||| |||||||    
T  10653036 tacatgatggaacatgcattagggttttcatcactaaacatgttggtgag 10652987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University