View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12722_low_8 (Length: 343)

Name: NF12722_low_8
Description: NF12722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12722_low_8
NF12722_low_8
[»] chr4 (1 HSPs)
chr4 (128-203)||(52302868-52302943)
[»] chr6 (1 HSPs)
chr6 (1-48)||(3176028-3176075)


Alignment Details
Target: chr4 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 128 - 203
Target Start/End: Original strand, 52302868 - 52302943
Alignment:
Q  128 caaaatatgaaataagaggaagattaggagtgtgttttccttgtgatagtgcagttatgttactgttactaacttg 203  Q
    |||||||| ||||||| |||||||||||||||||| |||||||||||||||||||||||||  |||| ||||||||    
T  52302868 caaaatattaaataagtggaagattaggagtgtgtcttccttgtgatagtgcagttatgttgttgttgctaacttg 52302943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 3176028 - 3176075
Alignment:
Q  1 gttgttgttcatcaaaatcgtaacactcgcaagtaatgaaataaaatc 48  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
T  3176028 gttgttgttcatcaaaatcgtaacactcgcaagtaatgaaataaaatc 3176075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University