View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12721_high_20 (Length: 281)

Name: NF12721_high_20
Description: NF12721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12721_high_20
NF12721_high_20
[»] chr8 (1 HSPs)
chr8 (8-264)||(563453-563709)


Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 8 - 264
Target Start/End: Complemental strand, 563709 - 563453
Alignment:
Q  8 gagcagagaatgaatgcaaccattctagctgatgggattaaaattgctataaggccaatgattgataatgtgagtggtgttgtagaaaaagttgaaattg 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  563709 gagcagagaatgaatgcaaccattctagctgatgggattaaaattgctataaggccaacgattgataatgtgagtggtgttgtagaaaaagttgaaattg 563610  T
Q  108 taaatgtcttgaagaggttaattgtagatgaaggaattgagattcgtggaagaatcaaagtactaaaagatgctgctgctaatgcaatgaaagtagatgg 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  563609 taaatgtcttgaagaggttaattgtagatgaaggaattgagattcgtagaagaatgaaagtactaaaagatgctgctgctaatgcaatgaaagtagatgg 563510  T
Q  208 atcttccataatcattatgtcccaattggtcaccaaatggacaaagatggaaggttt 264  Q
    |||||||||||||| |||||||||||||||||| |||||||||||||||||||||||    
T  563509 atcttccataatcactatgtcccaattggtcacaaaatggacaaagatggaaggttt 563453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University