View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1271_low_74 (Length: 400)

Name: NF1271_low_74
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1271_low_74
NF1271_low_74
[»] scaffold0130 (1 HSPs)
scaffold0130 (25-181)||(24514-24670)
[»] chr1 (3 HSPs)
chr1 (314-396)||(47799995-47800077)
chr1 (219-269)||(47799910-47799960)
chr1 (49-140)||(13796375-13796465)


Alignment Details
Target: scaffold0130 (Bit Score: 133; Significance: 5e-69; HSPs: 1)
Name: scaffold0130
Description:

Target: scaffold0130; HSP #1
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 25 - 181
Target Start/End: Original strand, 24514 - 24670
Alignment:
Q  25 tagtaatgcttaacatagcgaaatattgtttcacgacaggttcacaaaacatgcaaatcactactttgagaccaaactaataccactttttaatcacctg 124  Q
    |||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||| |||||||||||||||||||||||||||||||||||||||    
T  24514 tagtaatgcttaacatcgcgaaatattgtttcacgacaggttcacgaaacatgcatatcattactttgagaccaaactaataccactttttaatcacctg 24613  T
Q  125 atacaataaaagggtcctactactctctatcataatgggaaaaacgattggaaataa 181  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  24614 atgcaataaaagggtcctactactctctatcataatgggaaaaacgattgaaaataa 24670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 314 - 396
Target Start/End: Original strand, 47799995 - 47800077
Alignment:
Q  314 attttacattttgaaatatatgatgcacttctaatattgctactattgtaggttaaataaatctgtgcaaattcatctcactc 396  Q
    ||||||||||||||| |||||||||||||||||||||| |||||  |||||| | || || || ||||||||||| |||||||    
T  47799995 attttacattttgaagtatatgatgcacttctaatattactactgctgtaggctcaaaaattcagtgcaaattcaactcactc 47800077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 219 - 269
Target Start/End: Original strand, 47799910 - 47799960
Alignment:
Q  219 attgcacttgatggcaattatattggttatagacaaaattaaatgaggtga 269  Q
    ||||||||||| ||||| ||||||||||||||| ||| |||||||||||||    
T  47799910 attgcacttgaaggcaactatattggttatagataaagttaaatgaggtga 47799960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 140
Target Start/End: Complemental strand, 13796465 - 13796375
Alignment:
Q  49 attgtttcacgacaggttcacaaaacatgcaaatcactactttgagaccaaactaata-ccactttttaatcacctgatacaataaaagggtc 140  Q
    |||||||||||| |||||||| |  |||||| || |||||||||| |||||||||||| || |||||||||| | |||| ||| |||| ||||    
T  13796465 attgtttcacgataggttcacga--catgcatataactactttgacaccaaactaataccctctttttaatcgcatgatgcaacaaaatggtc 13796375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University