View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1271_low_209 (Length: 238)

Name: NF1271_low_209
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1271_low_209
NF1271_low_209
[»] chr4 (1 HSPs)
chr4 (1-95)||(25617459-25617553)
[»] chr3 (1 HSPs)
chr3 (195-238)||(34541581-34541624)


Alignment Details
Target: chr4 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 25617459 - 25617553
Alignment:
Q  1 atatatgatctataaaatcaccatcactgtcaaattttagttatgatttgtgcccacaaagaggtttattagatcaaaacatttttcattacctt 95  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  25617459 atatatgatctataaaatcaccatcactgtcacattttagttatgatttgtgcccacaaagaggtttattagatcaaaacatttttcatcacctt 25617553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 195 - 238
Target Start/End: Complemental strand, 34541624 - 34541581
Alignment:
Q  195 gggtaataatctatttttcttccttttattttcttatattttct 238  Q
    |||||||||||||||| ||||| ||||||||||||||| |||||    
T  34541624 gggtaataatctatttctcttcattttattttcttatagtttct 34541581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University