View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1271_low_199 (Length: 251)

Name: NF1271_low_199
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1271_low_199
NF1271_low_199
[»] chr6 (1 HSPs)
chr6 (72-184)||(6175291-6175403)


Alignment Details
Target: chr6 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 72 - 184
Target Start/End: Complemental strand, 6175403 - 6175291
Alignment:
Q  72 tatactctacgcttaagttctgcttcataaaaaggtcaaactcaatttcgaaaattagttacgaagaagtggagaaagtgataaaatcagtacaaaaatc 171  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  6175403 tatactctacgcttaagttctgcttcataaaaaggtcaaactcaatttcgaaaattagttatgaagaagtggagaaagtgataaaatcagtacaaaaatc 6175304  T
Q  172 caagttaatgagc 184  Q
    |||||||||||||    
T  6175303 caagttaatgagc 6175291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University