View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1271_low_157 (Length: 267)

Name: NF1271_low_157
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1271_low_157
NF1271_low_157
[»] chr2 (1 HSPs)
chr2 (55-167)||(3947472-3947584)


Alignment Details
Target: chr2 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 55 - 167
Target Start/End: Complemental strand, 3947584 - 3947472
Alignment:
Q  55 ctacttttctatactctatcaattagctgcacaatacatcataagatatagacttaaatatttaagctatttcaaatgcatctctaataaatttggggtg 154  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3947584 ctacttttctatactctatcaattagctgcacaatacatcataagatatagacttaaatatttaagctatttcaaatgcatctctaataaatttggggtg 3947485  T
Q  155 tgattgattacac 167  Q
    |||||||||||||    
T  3947484 tgattgattacac 3947472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University