View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12715_high_31 (Length: 250)

Name: NF12715_high_31
Description: NF12715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12715_high_31
NF12715_high_31
[»] chr8 (2 HSPs)
chr8 (92-239)||(71224-71372)
chr8 (24-93)||(71393-71462)


Alignment Details
Target: chr8 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 92 - 239
Target Start/End: Complemental strand, 71372 - 71224
Alignment:
Q  92 aacataagtctattttactcaataaggtgtggtgataatttttggttcttcaaatttaaatttactttaatcaataata-tataacttttctataactga 190  Q
    |||||||||||||||| |||||||| |||| ||||||||||||||||||| |||||||||||||||||||   || ||| ||||| ||||||||||||||    
T  71372 aacataagtctattttgctcaataaagtgtcgtgataatttttggttcttaaaatttaaatttactttaactgatgataatataatttttctataactga 71273  T
Q  191 gtgcttttacaatttagagccaatgtatccaaccaaatacataattcat 239  Q
     |||||||||||||||||||||||||||||||||||| |||||||||||    
T  71272 ctgcttttacaatttagagccaatgtatccaaccaaacacataattcat 71224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 93
Target Start/End: Complemental strand, 71462 - 71393
Alignment:
Q  24 tttccttttattgtactttattaaatcttaattgattatgtgagtttgattcctagcaaactgttaaaaa 93  Q
    ||||||||||||| ||| | |||||||| ||  |||||  ||||||||||||||||||||||||||||||    
T  71462 tttccttttattgaactctcttaaatctgaaccgattagttgagtttgattcctagcaaactgttaaaaa 71393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University