View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12713_low_5 (Length: 253)

Name: NF12713_low_5
Description: NF12713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12713_low_5
NF12713_low_5
[»] chr3 (2 HSPs)
chr3 (128-236)||(49354204-49354312)
chr3 (13-83)||(49354359-49354429)


Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 128 - 236
Target Start/End: Complemental strand, 49354312 - 49354204
Alignment:
Q  128 tttatttcatttttgtgatttaatgtaattgggtttggttggtatgcaggaattgaagcacgagggtttgtgtttggttctgcagttgcgttgggcattg 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49354312 tttatttcatttttgtgatttaatgtaattgggtttggttggtatgcaggaattgaagcacgagggtttgtgtttggttctgcagttgcgttgggcattg 49354213  T
Q  228 gtgcaaagt 236  Q
    |||||||||    
T  49354212 gtgcaaagt 49354204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 13 - 83
Target Start/End: Complemental strand, 49354429 - 49354359
Alignment:
Q  13 cagagacatgcacatttcagttgttgctggtatggtactacatcactattaccctcatgcaatactcattt 83  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  49354429 cagagacatgcacatttcagttgttgctggtatggtactacatcactcttaccctcatgcaatactcattt 49354359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University