View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1270_low_96 (Length: 209)

Name: NF1270_low_96
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1270_low_96
NF1270_low_96
[»] chr2 (1 HSPs)
chr2 (1-123)||(2987151-2987273)
[»] chr1 (1 HSPs)
chr1 (1-123)||(45117104-45117226)
[»] chr4 (1 HSPs)
chr4 (1-123)||(26721683-26721805)


Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 2987151 - 2987273
Alignment:
Q  1 aaaaatgaaccaagagaagaggatttcagttagattcacgacaacagaggatttcatagacgaaggatgaatggtgttgtcgctgccatccattcaagga 100  Q
    |||||||||||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||||    
T  2987151 aaaaatgaaccaagaggagaggatttcagttagattcacgacgacagaggatttcgtagacgaaggatgaaaggtgttgtcgctgccatcctttcaagga 2987250  T
Q  101 atgtaagaggcttatcactctct 123  Q
    |||||||||||||||||||||||    
T  2987251 atgtaagaggcttatcactctct 2987273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 45117226 - 45117104
Alignment:
Q  1 aaaaatgaaccaagagaagaggatttcagttagattcacgacaacagaggatttcatagacgaaggatgaatggtgttgtcgctgccatccattcaagga 100  Q
    |||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||    
T  45117226 aaaaatgaaccaagaggagaggatttcagttagattcacgacgacagaggatttcatagacgaaggatgaaaggtgttgtcgctgccatcctttcaagga 45117127  T
Q  101 atgtaagaggcttatcactctct 123  Q
    |||||||||||| ||||||||||    
T  45117126 atgtaagaggctcatcactctct 45117104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 26721683 - 26721805
Alignment:
Q  1 aaaaatgaaccaagagaagaggatttcagttagattcacgacaacagaggatttcatagacgaaggatgaatggtgttgtcgctgccatccattcaagga 100  Q
    ||||||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||    
T  26721683 aaaaatgaaccaaaaggagaggatttcagttagattcacgacgacagaggatttcatagacgaaggatgaatggtgttgtcgctgctatcctttcaagga 26721782  T
Q  101 atgtaagaggcttatcactctct 123  Q
    |||| ||||||||||||||||||    
T  26721783 atgttagaggcttatcactctct 26721805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University