View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1270_high_27 (Length: 360)

Name: NF1270_high_27
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1270_high_27
NF1270_high_27
[»] chr1 (1 HSPs)
chr1 (2-177)||(16951169-16951344)


Alignment Details
Target: chr1 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 2 - 177
Target Start/End: Complemental strand, 16951344 - 16951169
Alignment:
Q  2 gtacatgcttatgaaagctgttagatagcaagtcaataagatttagaccggggaaggagttgatgcaacaacattgaataatcgagacacatctccttcg 101  Q
    |||||||||||||||| | ||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  16951344 gtacatgcttatgaaaaccgttagatagcaagtcaataagatttagacaggggaagaagttgatgcaacaacattgaataatcgagacacatctccttcg 16951245  T
Q  102 caagagctataagccttcgatgaatgccataaagttcagcttaaaggatgtcagttgaacgctcataatataatga 177  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16951244 caagagctataagccttcgatgaatgccataaagttcagcttaaaggatgtcagttgaacgctcataatataatga 16951169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University