View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12709_low_20 (Length: 219)

Name: NF12709_low_20
Description: NF12709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12709_low_20
NF12709_low_20
[»] chr5 (1 HSPs)
chr5 (13-201)||(15628460-15628648)
[»] chr7 (1 HSPs)
chr7 (17-201)||(22933028-22933212)
[»] chr2 (1 HSPs)
chr2 (12-51)||(24382698-24382737)
[»] chr1 (1 HSPs)
chr1 (15-51)||(36386045-36386081)


Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 201
Target Start/End: Complemental strand, 15628648 - 15628460
Alignment:
Q  13 gcagagatagagaaaaatgggatgataagattaacaaatcacacaaacaatgaaatgggccatgctttttacacattaccttttcagctaaggaactcga 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  15628648 gcagagatagagaaaaatgggatgataagattaacaaatcacacaaacaatgaaatgggccatgctttttactcattaccttttcagctaaggaactcga 15628549  T
Q  113 caactcgtaaagcttactcattttcttcatcttttgctcttgctgttgtccctgagtatcctaatataggtggtcatggcatggctttc 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15628548 caactcgtaaagcttactcattttcttcatcttttgctcttgctgttgtccctgagtatcctaatataggtggtcatggcatggctttc 15628460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 17 - 201
Target Start/End: Original strand, 22933028 - 22933212
Alignment:
Q  17 agatagagaaaaatgggatgataagattaacaaatcacacaaacaatgaaatgggccatgctttttacacattaccttttcagctaaggaactcgacaac 116  Q
    |||||||||||||||| || ||||||||||||||| |  ||| |||   ||||||||||||||||||| |   |||||||||||||| |||||| |||||    
T  22933028 agatagagaaaaatggaataataagattaacaaatgattcaagcaaattaatgggccatgctttttactctcaaccttttcagctaaagaactcaacaac 22933127  T
Q  117 tcgtaaagcttactcattttcttcatcttttgctcttgctgttgtccctgagtatcctaatataggtggtcatggcatggctttc 201  Q
    | |||||||||  || ||||| ||| | |||||| |||||||||| |||||||||||||   | |||||||||||||||||||||    
T  22933128 tggtaaagctttttccttttcatcaacctttgctattgctgttgttcctgagtatcctagagttggtggtcatggcatggctttc 22933212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 51
Target Start/End: Complemental strand, 24382737 - 24382698
Alignment:
Q  12 agcagagatagagaaaaatgggatgataagattaacaaat 51  Q
    ||||||||||||||||||||| || |||||||||||||||    
T  24382737 agcagagatagagaaaaatggtataataagattaacaaat 24382698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 51
Target Start/End: Original strand, 36386045 - 36386081
Alignment:
Q  15 agagatagagaaaaatgggatgataagattaacaaat 51  Q
    |||||||||||||||||| || |||||||||||||||    
T  36386045 agagatagagaaaaatggtataataagattaacaaat 36386081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University