View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12705_low_4 (Length: 347)

Name: NF12705_low_4
Description: NF12705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12705_low_4
NF12705_low_4
[»] chr7 (2 HSPs)
chr7 (151-332)||(20139246-20139427)
chr7 (69-114)||(20139713-20139758)


Alignment Details
Target: chr7 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 151 - 332
Target Start/End: Complemental strand, 20139427 - 20139246
Alignment:
Q  151 aggatttgctacatcctctatgcataaatgcgccttgcaaaatggtagaccaaagtcttaacatctttagggttgtggttttcttgggatatcctggtat 250  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  20139427 aggatttgctacatcctctatgcataaatgcgccttgcaaaatggtagaccaaagtcttaacatctttagggttgtggttttcttcggatatcctggtat 20139328  T
Q  251 gagaacatcatacttgggcaaaatattgagatcttgtcaacaataggtgtcctgttgtagttaacatgtagtgtcgttctct 332  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  20139327 gagaacatcatacttgggcaaaatatcgagatcttgtcaacaataggtgtccggttgtagttaacatgtagtgtcgttctct 20139246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 69 - 114
Target Start/End: Complemental strand, 20139758 - 20139713
Alignment:
Q  69 ttggtttcaatttagttttcttaatcattgattcattctttataga 114  Q
    |||||||||||||||||||||||||||| |||||||||||||||||    
T  20139758 ttggtttcaatttagttttcttaatcatagattcattctttataga 20139713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University