View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12705_low_2 (Length: 384)

Name: NF12705_low_2
Description: NF12705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12705_low_2
NF12705_low_2
[»] chr4 (1 HSPs)
chr4 (133-189)||(44109984-44110040)
[»] chr2 (2 HSPs)
chr2 (332-367)||(9844097-9844132)
chr2 (332-367)||(9849755-9849790)
[»] chr5 (1 HSPs)
chr5 (133-185)||(6377547-6377599)


Alignment Details
Target: chr4 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 133 - 189
Target Start/End: Complemental strand, 44110040 - 44109984
Alignment:
Q  133 gctagaatatgttttttattcaagggtatttttgtactttcaaaagtaatcaatact 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  44110040 gctagaatatgttttttattcaagggtatttttgtactttcaaaaataatcaatact 44109984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 367
Target Start/End: Complemental strand, 9844132 - 9844097
Alignment:
Q  332 taaatgtgtttttagttcatacaaaatcacaagatt 367  Q
    ||||||||||||||||||||||||||||||||||||    
T  9844132 taaatgtgtttttagttcatacaaaatcacaagatt 9844097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 332 - 367
Target Start/End: Complemental strand, 9849790 - 9849755
Alignment:
Q  332 taaatgtgtttttagttcatacaaaatcacaagatt 367  Q
    ||||| ||||||||||||||||||||||||||||||    
T  9849790 taaatttgtttttagttcatacaaaatcacaagatt 9849755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 133 - 185
Target Start/End: Complemental strand, 6377599 - 6377547
Alignment:
Q  133 gctagaatatgttttttattcaagggtatttttgtactttcaaaagtaatcaa 185  Q
    |||| ||||||||||| || ||||||||||||||||||| ||||| |||||||    
T  6377599 gctataatatgtttttaatacaagggtatttttgtacttccaaaaataatcaa 6377547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University