View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12705_low_13 (Length: 207)

Name: NF12705_low_13
Description: NF12705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12705_low_13
NF12705_low_13
[»] chr2 (1 HSPs)
chr2 (15-189)||(45625891-45626065)


Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 189
Target Start/End: Complemental strand, 45626065 - 45625891
Alignment:
Q  15 agagcaggatgcatcatgttccccttcttcagtcagaagctcaagacccaactcatcttcaatatggtcagaagcagatatgagcaaaaactcgcatcct 114  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45626065 agagcaggatgcatcatgctccccttcttcagtcagaagctcaagacccaactcatcttcaatatggtcagaagcagatatgagcaaaaactcgcatcct 45625966  T
Q  115 tcatagtttagaaagtctggtgggtcagctggggcgaatctgacatgacctaattgtccttgcaggtgagccggg 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45625965 tcatagtttagaaagtctggtgggtcagctggggcgaatctgacatgacctaattgtccttgcaggtgagccggg 45625891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University