View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1269_low_5 (Length: 364)

Name: NF1269_low_5
Description: NF1269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1269_low_5
NF1269_low_5
[»] chr4 (2 HSPs)
chr4 (126-271)||(21113279-21113424)
chr4 (25-60)||(21113490-21113525)
[»] chr5 (1 HSPs)
chr5 (260-349)||(19305491-19305579)


Alignment Details
Target: chr4 (Bit Score: 146; Significance: 8e-77; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 126 - 271
Target Start/End: Complemental strand, 21113424 - 21113279
Alignment:
Q  126 ctatgtcatgatatgtccacgagcattcaatttggattatgaaattgatgattttgtcaacctctataattggaaggatatattttgttttaacaggaat 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21113424 ctatgtcatgatatgtccacgagcattcaatttggattatgaaattgatgattttgtcaacctctataattggaaggatatattttgttttaacaggaat 21113325  T
Q  226 aatttaaaaaatatcgggtgtattatactattgggataggtgtagt 271  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  21113324 aatttaaaaaatatcgggtgtattatactattgggataggtgtagt 21113279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 25 - 60
Target Start/End: Complemental strand, 21113525 - 21113490
Alignment:
Q  25 gttgtttggttttgtttgtgttaggattacttcatc 60  Q
    ||||||||||||||||||||||||| ||||||||||    
T  21113525 gttgtttggttttgtttgtgttagggttacttcatc 21113490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 260 - 349
Target Start/End: Original strand, 19305491 - 19305579
Alignment:
Q  260 gataggtgtagtttttagtgagttttgttgaggtgcttgtttgattagtgtaatgggtggcttgtttgtattaggggtttttgtttggtt 349  Q
    ||||| ||||||||||||||||||||||||| | || |||||||||||||||| ||||||||||||||||||||||| ||||||||||||    
T  19305491 gatagctgtagtttttagtgagttttgttgaagggcctgtttgattagtgtaacgggtggcttgtttgtattagggg-ttttgtttggtt 19305579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University