View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1269_low_11 (Length: 295)

Name: NF1269_low_11
Description: NF1269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1269_low_11
NF1269_low_11
[»] chr2 (2 HSPs)
chr2 (133-225)||(12153056-12153148)
chr2 (52-81)||(12152975-12153004)


Alignment Details
Target: chr2 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 133 - 225
Target Start/End: Original strand, 12153056 - 12153148
Alignment:
Q  133 taaagatcatgaagatactttatagccaaactcgctggtcattttaatgtaacattcccatgacacctttgttgccatcccaaatcatcttac 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||    
T  12153056 taaagatcatgaagatactttatagccaaactcgctggtcattttcatgtaacattcccatgacaactttgttgccatcccaaatcatcttac 12153148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 81
Target Start/End: Original strand, 12152975 - 12153004
Alignment:
Q  52 attattcttagtgaaaggtggagaatgtga 81  Q
    ||||||||||||||||||||||||||||||    
T  12152975 attattcttagtgaaaggtggagaatgtga 12153004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University