View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12698_high_2 (Length: 750)

Name: NF12698_high_2
Description: NF12698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12698_high_2
NF12698_high_2
[»] chr8 (2 HSPs)
chr8 (475-595)||(24942002-24942119)
chr8 (277-310)||(20515595-20515628)
[»] chr4 (1 HSPs)
chr4 (345-419)||(11299382-11299456)
[»] chr2 (1 HSPs)
chr2 (306-409)||(35189933-35190036)


Alignment Details
Target: chr8 (Bit Score: 95; Significance: 4e-46; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 95; E-Value: 4e-46
Query Start/End: Original strand, 475 - 595
Target Start/End: Complemental strand, 24942119 - 24942002
Alignment:
Q  475 gcaacatgtaactaatagaacaacatatgtcaatatgctcatatgcgtttttgaagtaactttcctctaaaactcacatagtgactcatccaagtctcta 574  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||    
T  24942119 gcaacatgtaactaatagaacaacatatatcaatatgctcatatgcgttttggaagtaactttcctctaaaactcacatagtgacacatccaagtctcta 24942020  T
Q  575 tacgtactcaaacaaacacct 595  Q
    |||   |||||||||||||||    
T  24942019 tac---ctcaaacaaacacct 24942002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 277 - 310
Target Start/End: Original strand, 20515595 - 20515628
Alignment:
Q  277 agaagttgaatgattgaagatgcttccagagatg 310  Q
    ||||||||||||||||||||||||||||||||||    
T  20515595 agaagttgaatgattgaagatgcttccagagatg 20515628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 345 - 419
Target Start/End: Original strand, 11299382 - 11299456
Alignment:
Q  345 atggaggttttggttgagaggaatgaaaggatgtggcagagtatagagtctggtaaggtgcttattctgtcaatg 419  Q
    |||| ||||||||||| |||||| || | |||||||||||||| |||||||||||   |||||| ||||||||||    
T  11299382 atggtggttttggttgggaggaaggagaagatgtggcagagtacagagtctggtagattgcttagtctgtcaatg 11299456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 306 - 409
Target Start/End: Original strand, 35189933 - 35190036
Alignment:
Q  306 agatggcgccagcggcgagaaacgagagagattgttgatatggaggttttggttgagaggaatgaaaggatgtggcagagtatagagtctggtaaggtgc 405  Q
    ||||||||||| |||||||| ||||||| ||||||||  | || | ||||||||| |||||| || || || |||||||| |  |||||||||| ||||     
T  35189933 agatggcgccaacggcgagagacgagagggattgttgtgacggtgattttggttgggaggaaggagagtatatggcagaggagtgagtctggtagggtgt 35190032  T
Q  406 ttat 409  Q
    ||||    
T  35190033 ttat 35190036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University