View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12688_low_18 (Length: 205)

Name: NF12688_low_18
Description: NF12688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12688_low_18
NF12688_low_18
[»] chr4 (1 HSPs)
chr4 (1-182)||(20925978-20926159)
[»] chr1 (1 HSPs)
chr1 (23-112)||(40689668-40689757)
[»] chr7 (1 HSPs)
chr7 (23-97)||(7687872-7687946)


Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 20925978 - 20926159
Alignment:
Q  1 cttctcctcagccataattttaggttttttgtgacttgccctgtgaccacccaaagcttgaaaagaaggaaaagttctgttacatgttttgcattcataa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20925978 cttctcctcagccataattttaggttttttgtgacttgccctgtgaccacccaaagcttgaaaagaaggaaaagttctgttacatgttttgcattcataa 20926077  T
Q  101 atatacaaaccaagttttgtgctagtctcaccaannnnnnnatttccatgactacccttttcccttttattctcatcaacaa 182  Q
    ||||||||||||||||||||||||||||||||||       ||||||||||||||||||| |||||||||||||||||||||    
T  20926078 atatacaaaccaagttttgtgctagtctcaccaatttttttatttccatgactaccctttacccttttattctcatcaacaa 20926159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 23 - 112
Target Start/End: Complemental strand, 40689757 - 40689668
Alignment:
Q  23 ggttttttgtgacttgccctgtgaccacccaaagcttgaaaagaaggaaaagttctgttacatgttttgcattcataaatatacaaacca 112  Q
    ||||| ||||||||||| || || ||||| |  |||||||| ||||| || |||||||| ||||||||||||||||||| ||| ||||||    
T  40689757 ggtttcttgtgacttgctctatggccaccaagggcttgaaatgaagggaatgttctgttgcatgttttgcattcataaacatagaaacca 40689668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 97
Target Start/End: Original strand, 7687872 - 7687946
Alignment:
Q  23 ggttttttgtgacttgccctgtgaccacccaaagcttgaaaagaaggaaaagttctgttacatgttttgcattca 97  Q
    ||||| |||||||||||||| |||||||| |  |||||||| ||||||||   ||| ||||||||||| ||||||    
T  7687872 ggtttcttgtgacttgccctatgaccacctagggcttgaaatgaaggaaattgtctattacatgttttacattca 7687946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University