View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12669_low_11 (Length: 258)

Name: NF12669_low_11
Description: NF12669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12669_low_11
NF12669_low_11
[»] chr1 (1 HSPs)
chr1 (16-248)||(50263699-50263931)


Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 16 - 248
Target Start/End: Complemental strand, 50263931 - 50263699
Alignment:
Q  16 catttttaaggcctttaaatttaaagggtcttattttggtacaaccattttttggtggaaaagaaagaacattatcagagaaatgcatggaacaattatc 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50263931 catttttaaggcctttaaatttaaagggtcttattttggtacaaccattttttggtggaaaagaaagaacattatcagagaaatgcatggaacaattatc 50263832  T
Q  116 tggttctgctttgaatttagcagcttcagatacttattggcgattggcattaccatatggcgaagatcgcgatcatccatggtgtaatccattggtgaaa 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50263831 tggttctgctttgaatttagcagcttcagatacttattggcgattggcattaccatatggcgaagatcgcgatcatccatggtgtaatccattggtgaaa 50263732  T
Q  216 atggaggaattgaagctactgatgatgcctatg 248  Q
    |||||||||||||||||||||||||||||||||    
T  50263731 atggaggaattgaagctactgatgatgcctatg 50263699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University