View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12669_high_14 (Length: 212)

Name: NF12669_high_14
Description: NF12669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12669_high_14
NF12669_high_14
[»] chr4 (1 HSPs)
chr4 (34-193)||(23663951-23664110)


Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 34 - 193
Target Start/End: Original strand, 23663951 - 23664110
Alignment:
Q  34 gatcatatggggtttcaaattggtattggtaatggtaactcaacttctgtttctgtttctgcttcttctgttgctggaggtgtcggagttgaaccatggc 133  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23663951 gatcatatggggtttcaaattggtattggtaatggtaactcaacttctgtttctgtttctgcttcttctgttgctggaggtgtcggagttgaaccatggc 23664050  T
Q  134 gtaatttgcagcaatttcctttcttgaatactttcgaatcaaactcttctggaaataatc 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23664051 gtaatttgcagcaatttcctttcttgaatactttcgaatcaaactcttctggaaataatc 23664110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University