View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12664_high_6 (Length: 230)

Name: NF12664_high_6
Description: NF12664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12664_high_6
NF12664_high_6
[»] chr4 (1 HSPs)
chr4 (14-215)||(52491113-52491314)
[»] chr1 (1 HSPs)
chr1 (31-215)||(21946119-21946304)
[»] chr5 (1 HSPs)
chr5 (19-100)||(5404205-5404286)
[»] chr8 (1 HSPs)
chr8 (70-137)||(30927165-30927232)
[»] chr2 (1 HSPs)
chr2 (16-83)||(3085563-3085630)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 14 - 215
Target Start/End: Original strand, 52491113 - 52491314
Alignment:
Q  14 cagagagaggtgcgctaatcaacacacggcggacgtttgatggggctgtgaaatgaaccttgcggctcttgcgacagctgcttgaaagaagaagaaacat 113  Q
    |||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |    
T  52491113 cagagagaggtgcgctaatcaacacacgacggacgtttgatggggcggtgaaatgaaccttgcggctcttgtgacagctgcttgaaagaagaagaaacgt 52491212  T
Q  114 ggatgaatcaattgcagatctgaannnnnnncgtattactcttctatgaaatcgtgaggaagaataatggaagcaaagaagaaggaaaacagggtgttgt 213  Q
    |||||||| |||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52491213 ggatgaatgaattgcagatctgaatttttttcgtattactcttctatgaaatcgtgaggaagaataatggaagcaaagaagaaggaaaacagggtgttgt 52491312  T
Q  214 tg 215  Q
    ||    
T  52491313 tg 52491314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 31 - 215
Target Start/End: Complemental strand, 21946304 - 21946119
Alignment:
Q  31 atcaacacacggcggacgtttgatggggctgtgaaatgaaccttgcggctcttgcgacagctgcttgaaagaagaagaaacatggatgaatcaattgcag 130  Q
    ||||||||||| |||||||||| || ||| || ||||||||||||||||||||||||| | |||||||||||||||||||||||| ||||| |||||||     
T  21946304 atcaacacacgacggacgtttggtgtggcggtaaaatgaaccttgcggctcttgcgacggatgcttgaaagaagaagaaacatggctgaatgaattgcat 21946205  T
Q  131 atctgaa--nnnnnnncgtattactcttctatgaaatcgtgaggaagaataatggaagcaaagaagaaggaaaacagggtgttgttg 215  Q
    |||||||         | |||| |||||||||| | | ||||| |||||||||||||||||||||||| ||||||| ||||||||||    
T  21946204 atctgaatttttttttcttatttctcttctatggagttgtgagaaagaataatggaagcaaagaagaa-gaaaacaaggtgttgttg 21946119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 5404286 - 5404205
Alignment:
Q  19 agaggtgcgctaatcaacacacggcggacgtttgatggggctgtgaaatgaaccttgcggctcttgcgacagctgcttgaaa 100  Q
    ||||||||||| ||||||||||| |||||| |||||||||| ||||||||| |||||||||||||||||| |||||||||||    
T  5404286 agaggtgcgctcatcaacacacgacggacgcttgatggggcggtgaaatgagccttgcggctcttgcgacggctgcttgaaa 5404205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 70 - 137
Target Start/End: Original strand, 30927165 - 30927232
Alignment:
Q  70 accttgcggctcttgcgacagctgcttgaaagaagaagaaacatggatgaatcaattgcagatctgaa 137  Q
    |||||||||||||| |||| | |||||||||||||||||||||||||||||| ||||||| |||||||    
T  30927165 accttgcggctcttccgacggttgcttgaaagaagaagaaacatggatgaatgaattgcatatctgaa 30927232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 83
Target Start/End: Original strand, 3085563 - 3085630
Alignment:
Q  16 gagagaggtgcgctaatcaacacacggcggacgtttgatggggctgtgaaatgaaccttgcggctctt 83  Q
    ||||| |||||||| || || |||||||||||| ||||||| || ||||||||| |||| ||||||||    
T  3085563 gagagtggtgcgctcattaagacacggcggacgcttgatggcgccgtgaaatgagccttacggctctt 3085630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University