View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12661_high_20 (Length: 359)

Name: NF12661_high_20
Description: NF12661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12661_high_20
NF12661_high_20
[»] chr8 (1 HSPs)
chr8 (213-343)||(39033610-39033740)


Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 213 - 343
Target Start/End: Original strand, 39033610 - 39033740
Alignment:
Q  213 tacttttgcatttttgaagtccctttatctttcccattttgttacgctcactcatgcaccttataaaacctattttatactttataaatgtcattttttc 312  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||    
T  39033610 tacttttgcatttttgaagtccctgtatctttcccattttgttacgctcactcatgcaccttataaaacctattttatactttgtaaatgtccttttttc 39033709  T
Q  313 ctttcgcaattagctgattttaacttttaac 343  Q
    |||| ||||||||||||||||||||||||||    
T  39033710 ctttagcaattagctgattttaacttttaac 39033740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University