View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12658_low_26 (Length: 241)

Name: NF12658_low_26
Description: NF12658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12658_low_26
NF12658_low_26
[»] chr6 (1 HSPs)
chr6 (24-226)||(31296419-31296625)


Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 24 - 226
Target Start/End: Complemental strand, 31296625 - 31296419
Alignment:
Q  24 cttagagagtttaatctc----gttaaactcaatcctattgaaattgatattagatttgtttaggatctttgaccaactataacaattaaataaaatata 119  Q
    ||||||||||||||||||    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31296625 cttagagagtttaatctcttccgttaaactcaaccctattgaaattgatattagatttgtttaggatctttgaccaactataacaattaaataaaatata 31296526  T
Q  120 aattgtgctcttccaacattgtttgcttgttagagatgatttcttaaatcactagtcgtcaatgttaacgattgatttagtggctgatttataactatgt 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31296525 aattgtgctcttccaacattgtttgcttgttagagatgatttcttaaatcactagtcgtcaatgttaacgattgatttagtggctgatttataactatgt 31296426  T
Q  220 atatctt 226  Q
    |||||||    
T  31296425 atatctt 31296419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University