View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1264_2D_high_25 (Length: 208)

Name: NF1264_2D_high_25
Description: NF1264_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1264_2D_high_25
NF1264_2D_high_25
[»] chr5 (2 HSPs)
chr5 (1-192)||(39959940-39960131)
chr5 (5-78)||(3332035-3332108)


Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 39959940 - 39960131
Alignment:
Q  1 aatttatttagcgggtgctcaaggacaagttgttggaggtgctgtagttggtgctttgattgcttcaggacctgttgtgatcatggctgcatcattcatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39959940 aatttatttagcgggtgctcaaggacaagttgttggaggtgctgtagttggtgctttgattgcttcaggacctgttgtgatcatggctgcatcattcatg 39960039  T
Q  101 catgctactttcgatcgtctgccactggaagacgatgaacttgctgctgcaatgcagaatcagcattaccaaaatggacgcgcggcacaaca 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39960040 catgctactttcgatcgtctgccactggaagacgatgaacttgctgctgcaatgcagaatcagcattaccaaaatggacgcgcggcacaaca 39960131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 5 - 78
Target Start/End: Complemental strand, 3332108 - 3332035
Alignment:
Q  5 tatttagcgggtgctcaaggacaagttgttggaggtgctgtagttggtgctttgattgcttcaggacctgttgt 78  Q
    ||||||||||| |  ||||| || |||||||| ||   ||| |||||||||||||||||||| |||||||||||    
T  3332108 tatttagcgggcggacaagggcaggttgttggtggaagtgttgttggtgctttgattgcttctggacctgttgt 3332035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University