View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1263_low_11 (Length: 290)

Name: NF1263_low_11
Description: NF1263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1263_low_11
NF1263_low_11
[»] chr8 (2 HSPs)
chr8 (158-222)||(2846980-2847044)
chr8 (158-218)||(3161152-3161212)
[»] chr4 (1 HSPs)
chr4 (82-149)||(46899009-46899076)


Alignment Details
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 158 - 222
Target Start/End: Original strand, 2846980 - 2847044
Alignment:
Q  158 tatcaacactccctgccaacttgtgcacatacatacattatatttgatcccactaccctccacgt 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2846980 tatcaacactccctgccaacttgtgcacatacatacattatatttgatcccactaccctccacgt 2847044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 158 - 218
Target Start/End: Complemental strand, 3161212 - 3161152
Alignment:
Q  158 tatcaacactccctgccaacttgtgcacatacatacattatatttgatcccactaccctcc 218  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||    
T  3161212 tatcaacactccctgccaacttgtgcgcatacatacattatatttgatcgcactaccctcc 3161152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 82 - 149
Target Start/End: Original strand, 46899009 - 46899076
Alignment:
Q  82 tggtgaggaatgtccttatggggagaagtgtagttttcttcatgaggatcctactaagtttagggatg 149  Q
    ||||||||||||||||||||| || |||||||| |||||||||||||||||| ||| |||||||||||    
T  46899009 tggtgaggaatgtccttatggtgataagtgtagctttcttcatgaggatcctgctaggtttagggatg 46899076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University