View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12638_low_3 (Length: 258)

Name: NF12638_low_3
Description: NF12638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12638_low_3
NF12638_low_3
[»] chr5 (1 HSPs)
chr5 (18-250)||(26122941-26123173)


Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 250
Target Start/End: Complemental strand, 26123173 - 26122941
Alignment:
Q  18 atggttttcattcttgttttatgacccctagagtatctgagtatctatgtttatagataaaattgtgccttatattgactattcataaataatagatttc 117  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26123173 atggttttcattcttgttttatgacccctaaagtatctgagtatctatgtttatagataaaattgtgccttatattgactattcataaataatagatttc 26123074  T
Q  118 aaaggtttctgcaatgaccattcaaaaatattagtattcaattaataatatgattttaatacatcccttgtgttggttttgtgcatgcgaatgtgccttt 217  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||    
T  26123073 aaaggtttctgcaatgaccattcaaaaatatttgtattcaattaataatatgattttaatacatctctcgtgttggttttgtgcatgcgaatgtgccttt 26122974  T
Q  218 cctttgaatttgaatcccaaagtcagtgaacga 250  Q
     |||||||||||||||||||||| |||||||||    
T  26122973 actttgaatttgaatcccaaagttagtgaacga 26122941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University