View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12634_low_19 (Length: 322)

Name: NF12634_low_19
Description: NF12634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12634_low_19
NF12634_low_19
[»] chr3 (1 HSPs)
chr3 (1-274)||(21710728-21710997)


Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 21710997 - 21710728
Alignment:
Q  1 tgtaatttgaaaattttagtttttccagataaaatgcatgtgactagaaaatggtttcatgatactcttgtagtgataaactttgcagttacatcatagt 100  Q
    ||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||||||||||||| ||||||| || ||||||||||||    
T  21710997 tgtaatttgaaaattttagttttgccagataaaatgcatgtgagtagaaaatgttttcatgatactcttgtagtgagaaacttttcatttacatcatagt 21710898  T
Q  101 atttttccgtaatttaattctgtggatgcgctagctattgagggatcatgtgataaaacagatgaacttctaaaccaaaatatcagttagttcccacaaa 200  Q
    ||||||| |||||||||||||||||||||||||    |||||||||| ||| |||||||||||||||||||||||||||||||  |||||||||||| ||    
T  21710897 atttttctgtaatttaattctgtggatgcgcta----ttgagggatcgtgtcataaaacagatgaacttctaaaccaaaatattggttagttcccacgaa 21710802  T
Q  201 tgtggaggattgtttgaactttgaatgatgtacatattatttttaaagttgcaatgttttattttattgcacca 274  Q
    ||| | |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||    
T  21710801 tgtcggggattgtttgaactttgaatgatgtacatattctttttaaacttgcaatgttttattttattgcacca 21710728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University