View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1262_low_69 (Length: 266)

Name: NF1262_low_69
Description: NF1262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1262_low_69
NF1262_low_69
[»] chr1 (1 HSPs)
chr1 (1-237)||(46736964-46737200)


Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 46736964 - 46737200
Alignment:
Q  1 tgttgtttgagagattggatgtgtgctatgggataaaaggagcaattgttttttgaacagaacgtggatgaatgctatatcaacaggggatgttgttgct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46736964 tgttgtttgagagattggatgtgtgctatgggataaaaggagcaattgttttttgaacagaacgtggatgaatgctatatcaacaggggatgttgttgct 46737063  T
Q  101 catagaaaaccatgtatggatcatgatcacattccatattaatgaaggcatctgcactaccattagtttcacggtacacatgacacactctaacttcaca 200  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||    
T  46737064 catagaaaaccatgtatggatcatgatcgcattccatattaatgaaggcatctgcacaaccattagcttcacggtacacatgacacactctaacttcaca 46737163  T
Q  201 atctgtttgaagtatccgacgaatatgttgcactagc 237  Q
    |||||||||||||||||||||||||||||||||||||    
T  46737164 atctgtttgaagtatccgacgaatatgttgcactagc 46737200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University