View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1262_low_50 (Length: 332)

Name: NF1262_low_50
Description: NF1262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1262_low_50
NF1262_low_50
[»] chr4 (2 HSPs)
chr4 (195-304)||(40576784-40576894)
chr4 (13-107)||(40576679-40576774)


Alignment Details
Target: chr4 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 195 - 304
Target Start/End: Original strand, 40576784 - 40576894
Alignment:
Q  195 aagtgattggatgtgataaatgtgtcagtgtcgcgaagtgtcggtgctactgtaagagaccttaagttgatgga-tcttcatatactttaggggctaaat 293  Q
    |||||||||||||| |||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||||    
T  40576784 aagtgattggatgtaataaatgtgtcagtgtcgtgaagtgtcggtgctactttaagagaccttaagttgatggatttttcatatactttaggggctaaat 40576883  T
Q  294 tgaaagatttt 304  Q
    |||||||||||    
T  40576884 tgaaagatttt 40576894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 13 - 107
Target Start/End: Original strand, 40576679 - 40576774
Alignment:
Q  13 aatattacccttccattcgcctgcaggcatggtacttacttttatcttcaaattatgactgtatcttgatta-tttaaacttatgcaaatcatcat 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||    
T  40576679 aatattacccttccattcgcctgcaggcatggtacttacttttatcttcaaattatgagtgtatcttgattattttaaacttatgcaaatcatcat 40576774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University