View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12622_high_38 (Length: 206)

Name: NF12622_high_38
Description: NF12622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12622_high_38
NF12622_high_38
[»] chr4 (1 HSPs)
chr4 (22-196)||(37590428-37590602)


Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 22 - 196
Target Start/End: Complemental strand, 37590602 - 37590428
Alignment:
Q  22 tgatacaaaccaagagcctctccttcgtcaaccgagcacattagagcgaaccacattgttttagcaagtacaaattgcccttcatcatcacgggtacacc 121  Q
    ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37590602 tgatacaaaccaagagcatctccttcgtcaactgagcacattagagcgaaccacattgttttagcaagtacaaattgcccttcatcatcacgggtacacc 37590503  T
Q  122 caataccaaaccgattcctagaagccgaaaatgaggcatctactttacacttcattcttctgcgcctatgcttct 196  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||    
T  37590502 caataccaaaccgattcctagaagccgaaaatgaggcatctacattacacttcattcttctgcgccgaggcttct 37590428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University